Regulator exur in Bacillus subtilis subsp. subtilis str. 168


  • Comment - None
  • Complete Name - exur: bsu12370
  • Consensus Sequence - TCAAAATGTTAACGTTAACATTTTGA
  • Factor Type - LacI-GalR
  • Locus Tag - BSU12370
  • Mechanism - Transcription Factor
  • Name - exur
  • Sequence
  • Sinonyms - exuR yjmH BSU12370
  • Regulator UniProt Accession - Q9JMQ1


  • Browse other regulators for Bacillus subtilis subsp. subtilis str. 168

    Browse other organisms


    Genes regulated by exur in Bacillus subtilis subsp. subtilis str. 168:

    ProTReND 2019              University of Minho              Centre of Biological Engineering              Biosystems